|
extractfeat |
Function
Extract features from a sequenceDescription
extractfeat is a simple utility for extracting parts of a sequence that have been annotated as being a specific type of feature. These sub-sequences are writen to the output sequence file.If the feature is annotated as being in the reverse sense of a nucleic acid sequence, then that feature's sub-sequence is reverse-complemented before being written out.
It is often useful to have some information on the context of the feature. extractfeat allows you to specify a number of bases or residues before and/or after the feature to write out.
If you are interested in extracting the sequence of the region around the start or end of the feature, then this can also be specified.
'joined' features can either be extracted as individual sequences, or as a single concatenated sequence if the '-join' qualifier is used.
Please remember that the output feature sequence is only as good as the annotation. If you rely upon other people's, or other program's annotation of features, then some of these will be incorrect.
Usage
Here is a sample session with extractfeatTo write out the exons of a sequence:
% extractfeat tembl:hsfau1 -type exon stdout Extract features from a sequence >HSFAU1_408_504 [exon] H.sapiens fau 1 gene cagtgacgtgacacgcagcccacggtctgtactgacgcgccctcgcttcttcctctttct cgactccatcttcgcggtagctgggaccgccgttcag >HSFAU1_774_856 [exon] H.sapiens fau 1 gene tcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggcc aggaaacggtcgcccagatcaag >HSFAU1_951_1095 [exon] H.sapiens fau 1 gene gctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggc gcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctg gaagtagcaggccgcatgcttggag >HSFAU1_1557_1612 [exon] H.sapiens fau 1 gene gtaaagtccatggttccctggcccgtgctggaaaagtgagaggtcagactcctaag >HSFAU1_1787_1912 [exon] H.sapiens fau 1 gene gtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtac aaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaac tcttaa |
Go to the input files for this example
Example 2
To write out the exons with 10 extra bases at the start and end so that you can inspect the splice sites:
% extractfeat tembl:hsfau1 -type exon -before 10 -after 10 stdout Extract features from a sequence >HSFAU1_408_504 [exon] H.sapiens fau 1 gene ggtcgctcagcagtgacgtgacacgcagcccacggtctgtactgacgcgccctcgcttct tcctctttctcgactccatcttcgcggtagctgggaccgccgttcaggtaagaatgg >HSFAU1_774_856 [exon] H.sapiens fau 1 gene ctttactcagtcgccaatatgcagctctttgtccgcgcccaggagctacacaccttcgag gtgaccggccaggaaacggtcgcccagatcaaggtaaggctgc >HSFAU1_951_1095 [exon] H.sapiens fau 1 gene ttccctgtaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgct cctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccct gactaccctggaagtagcaggccgcatgcttggaggtgagtgaga >HSFAU1_1557_1612 [exon] H.sapiens fau 1 gene cccactacaggtaaagtccatggttccctggcccgtgctggaaaagtgagaggtcagact cctaaggtgagtgaga >HSFAU1_1787_1912 [exon] H.sapiens fau 1 gene ccttctccaggtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcg gatgcagtacaaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccc caatgccaactcttaagtcttttgta |
Example 3
To write out the 10 bases around the start of all 'exon' features in the tembl database:
% extractfeat tembl:* -type exon -before 5 -after -5 stdout Extract features from a sequence >HSFAU1_408_504 [exon] H.sapiens fau 1 gene ctcagcagtg >HSFAU1_774_856 [exon] H.sapiens fau 1 gene ctcagtcgcc >HSFAU1_951_1095 [exon] H.sapiens fau 1 gene tgtaggctca >HSFAU1_1557_1612 [exon] H.sapiens fau 1 gene tacaggtaaa >HSFAU1_1787_1912 [exon] H.sapiens fau 1 gene tccaggtggc >HSFOS_889_1029 [exon] Human fos proto-oncogene (c-fos), complete cds. ccacgatgat >HSFOS_1783_2034 [exon] Human fos proto-oncogene (c-fos), complete cds. tctaggactt >HSFOS_2466_2573 [exon] Human fos proto-oncogene (c-fos), complete cds. tctagttatc >HSFOS_2688_3329 [exon] Human fos proto-oncogene (c-fos), complete cds. tacaggagac >HSTS1_1001_1205 [exon] Homo sapiens gene for thymidylate synthase, exons 1, 2, 3, 4, 5, 6, 7, complete cds. gcgccatgcc >HSTS1_2895_2968 [exon] Homo sapiens gene for thymidylate synthase, exons 1, 2, 3, 4, 5, 6, 7, complete cds. ttcagatgaa >HSTS1_5396_5570 [exon] Homo sapiens gene for thymidylate synthase, exons 1, 2, 3, 4, 5, 6, 7, complete cds. tccagggatc >HSTS1_11843_11944 [exon] Homo sapiens gene for thymidylate synthase, exons 1, 2, 3, 4, 5, 6, 7, complete cds. tacagattat >HSTS1_13449_13624 [exon] Homo sapiens gene for thymidylate synthase, exons 1, 2, 3, 4, 5, 6, 7, complete cds. ctcagatctt >HSTS1_14133_14204 [exon] Homo sapiens gene for thymidylate synthase, exons 1, 2, 3, 4, 5, 6, 7, complete cds. tatagccagg >HSTS1_15613_15750 [exon] Homo sapiens gene for thymidylate synthase, exons 1, 2, 3, 4, 5, 6, 7, complete cds. tttagcttca >AB009062_75_503 [exon] Homo sapiens HERG gene, exon 6. tgcaggtcct >HSFERG2_50_196 [exon] Human apoferritin H gene exons 2-4 ttcagtctta >HSFERG2_453_578 [exon] Human apoferritin H gene exons 2-4 ttcagaaacc >HSFERG2_674_999 [exon] Human apoferritin H gene exons 2-4 tgcagttgtg >AP000504_13_134 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcactgtga >AP000504_868_930 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. gataccaaaa >AP000504_1081_1161 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cttaccaagc >AP000504_2752_2875 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cccacctctc >AP000504_3425_3584 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. gagacctcgg >AP000504_3818_4038 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. gttacccttt >AP000504_7507_7763 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ccagcccggg >AP000504_9766_9875 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ttcaggctgg >AP000504_10068_10193 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tccaggcgga >AP000504_10357_10463 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ttcaggtacc >AP000504_11631_11812 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cacagatctg >AP000504_13026_13434 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcaggtggt >AP000504_14850_15164 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. gagggggagt >AP000504_15284_15383 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctaaggtcga >AP000504_15505_15578 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcaggccgg >AP000504_15737_15856 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cctaggactt >AP000504_16337_16486 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tctaggcaat >AP000504_16676_16987 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tgcaggcact >AP000504_18955_19059 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tcccttcaaa >AP000504_19185_19264 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cttaccggtt >AP000504_19402_19442 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcaccaaat >AP000504_19797_19887 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcacctgtg >AP000504_20043_20390 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cctaccatgg >AP000504_20585_20645 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cttaccccca >AP000504_22296_22401 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. atccttgaaa >AP000504_23826_23936 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cccagctgac >AP000504_24719_25381 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cctaggtaag >AP000504_26111_26448 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. gctgtagagt >AP000504_28403_28525 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcacggttt >AP000504_28617_28671 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cttacccaag >AP000504_30215_30266 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tggccatggg >AP000504_31238_31363 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. aacaggtctc >AP000504_31486_31691 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctgagtgaaa >AP000504_33605_33675 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. gttcctcacc >AP000504_33846_34001 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcacctctg >AP000504_35893_36156 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tttacctgcc >AP000504_36240_36569 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcacctttg >AP000504_37069_37123 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cttacctgca >AP000504_40724_40877 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ggaagagcag >AP000504_41897_41953 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ggcaggatac >AP000504_42687_42753 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tgcaggcttc >AP000504_42999_43085 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cccaggttac >AP000504_46996_47081 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. accaggcatt >AP000504_50596_50669 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tgcagaggca >AP000504_50879_51001 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcaggaagg >AP000504_52110_52224 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cacagctacc >AP000504_52348_52449 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcagtgtaa >AP000504_53426_53489 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cctaggtgat >AP000504_53901_53950 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tacagctgga >AP000504_54324_54447 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tgcagggggt >AP000504_54909_55013 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. accagccacg >AP000504_55242_55305 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tctagggggc >AP000504_55723_55779 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tgaagatacc >AP000504_55925_55987 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cccagggttc >AP000504_56128_56204 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cgtaggtatc >AP000504_56288_56386 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. accagcctca >AP000504_56484_56530 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tgcaggggag >AP000504_56733_57055 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcaggctcg >AP000504_59988_60040 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cagagatgca >AP000504_63714_63775 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cacagcagcc >AP000504_64760_64927 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tctaggtaag >AP000504_66908_67344 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cccaggcagc >AP000504_71741_72164 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. actgtggaat >AP000504_72744_73649 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tttaccataa >AP000504_73962_74192 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcatggcct >AP000504_74520_74709 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cctacctggg >AP000504_74856_74931 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcaccaatg >AP000504_75374_75489 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcaccatct >AP000504_76058_76160 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcaccaggc >AP000504_77125_77207 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcacttcac >AP000504_77820_78148 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcaccggct >AP000504_79023_79187 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tgattagaat >AP000504_79451_80175 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. agcaggtctc >AP000504_81318_81943 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tgcaggtctc >AP000504_83295_85730 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ggctccccaa >AP000504_85819_85964 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. gagatgagga >AP000504_86305_86403 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cttaccttga >AP000504_86550_86648 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcactgtag >AP000504_86730_86803 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ccaaccttca >AP000504_87402_87556 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ctcacatgcg >AP000504_87948_88090 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. catacctcct >AP000504_91393_91628 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ccccgggcga >AP000504_92264_92384 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tttagagacc >AP000504_94413_94530 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ttcagatgaa >AP000504_94645_94841 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tgcagatgtt >AP000504_95076_95129 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cccagagtga >AP000504_95289_95363 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. tgtagagtga >AP000504_96214_96449 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ttcagtgtcg >AP000504_97518_97647 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cacagccatc >AP000504_98437_98634 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cgcagcacga >AP000504_98843_99095 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. ttcagatcaa >AP000504_99439_99516 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cccagattct >AP000504_99847_99959 [exon] Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 3/20. cacaggacag >AB000360_808_2266 [exon] Homo sapiens PIGC gene, complete cds. cttttagtaa >HSHBB_19289_19632 [exon] Human beta globin region on chromosome 11. ggagccaaca >HSHBB_19755_19977 [exon] Human beta globin region on chromosome 11. catagactcc >HSHBB_20833_21080 [exon] Human beta globin region on chromosome 11. aacagctcct >HSHBB_34478_34622 [exon] Human beta globin region on chromosome 11. tccacacact >HSHBB_34745_34967 [exon] Human beta globin region on chromosome 11. cacaggctcc >HSHBB_35854_36069 [exon] Human beta globin region on chromosome 11. aacagctcct >HSHBB_39414_39558 [exon] Human beta globin region on chromosome 11. tccacacact >HSHBB_39681_39903 [exon] Human beta globin region on chromosome 11. cacaggctcc >HSHBB_40770_40985 [exon] Human beta globin region on chromosome 11. aacagctcct >HSHBB_45710_45800 [exon] Human beta globin region on chromosome 11. acactgtagt >HSHBB_45922_46145 [exon] Human beta globin region on chromosome 11. cacagtctcc >HSHBB_46997_47124 [exon] Human beta globin region on chromosome 11. cccagctctt >HSHBB_54740_54881 [exon] Human beta globin region on chromosome 11. tgcttacact >HSHBB_55010_55232 [exon] Human beta globin region on chromosome 11. ctcagattac >HSHBB_56131_56389 [exon] Human beta globin region on chromosome 11. cgcagctctt >HSHBB_62137_62278 [exon] Human beta globin region on chromosome 11. tgcttacatt >HSHBB_62187_62278 [exon] Human beta globin region on chromosome 11. acaccatggt >HSHBB_62390_62408 [exon] Human beta globin region on chromosome 11. attggtctat >HSHBB_62409_62631 [exon] Human beta globin region on chromosome 11. cttaggctgc >HSHBB_63482_63742 [exon] Human beta globin region on chromosome 11. cacagctcct >GMGL01_363_460 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected). gaaatatggg >GMGL01_555_663 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected). aataggatat >GMGL01_2182_2286 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected). tgtaggtgcg >GMGL01_3065_3208 [exon] Glycine max leghemoglobin gene or pseudogene (no mRNA detected). cgtaggtggt |
Example 4
To extract the CDS region with the exons joined into one sequence:
% extractfeat tembl:hsfau1 -type CDS -join stdout Extract features from a sequence >HSFAU1_782_1912 [CDS] H.sapiens fau 1 gene atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg cccacctttggcaagaagaagggccccaatgccaactcttaa |
Example 5
To write out the 7 residues around all phosphorylated residues in the tsw database:
% extractfeat tsw:* -type mod_res -value phosphorylation* -before 3 -after -4 stdout Extract features from a sequence >OPSD_HUMAN_343_343 [mod_res] RHODOPSIN. TETSQVA >PAXI_HUMAN_118_118 [mod_res] PAXILLIN. EHVYSFP |
Go to the input files for this example
Command line arguments
Standard (Mandatory) qualifiers:
[-sequence] seqall Sequence database USA
[-outseq] seqout Output sequence USA
Additional (Optional) qualifiers:
-before integer If this value is greater than 0 then that
number of bases or residues before the
feature are included in the extracted
sequence. This allows you to get the context
of the feature. If this value is negative
then the start of the extracted sequence
will be this number of bases/residues before
the end of the feature. So a value of '10'
will start the extraction 10 bases/residues
before the start of the sequence, and a
value of '-10' will start the extraction 10
bases/residues before the end of the
feature. The output sequence will be padded
with 'N' or 'X' characters if the sequence
starts after the required start of the
extraction.
-after integer If this value is greater than 0 then that
number of bases or residues after the
feature are included in the extracted
sequence. This allows you to get the context
of the feature. If this value is negative
then the end of the extracted sequence will
be this number of bases/residues after the
start of the feature. So a value of '10'
will end the extraction 10 bases/residues
after the end of the sequence, and a value
of '-10' will end the extraction 10
bases/residues after the start of the
feature. The output sequence will be padded
with 'N' or 'X' characters if the sequence
ends before the required end of the
extraction.
-source string By default any feature source in the feature
table is shown. You can set this to match
any feature source you wish to show.
The source name is usually either the name
of the program that detected the feature or
it is the feature table (eg: EMBL) that the
feature came from.
The source may be wildcarded by using '*'.
If you wish to show more than one source,
separate their names with the character '|',
eg:
gene* | embl
-type string By default every feature in the feature
table is extracted. You can set this to be
any feature type you wish to extract.
See http://www3.ebi.ac.uk/Services/WebFeat/
for a list of the EMBL feature types and see
Appendix A of the Swissprot user manual in
http://www.expasy.ch/txt/userman.txt for a
list of the Swissprot feature types.
The type may be wildcarded by using '*'.
If you wish to extract more than one type,
separate their names with the character '|',
eg:
*UTR | intron
-sense integer By default any feature type in the feature
table is extracted. You can set this to
match any feature sense you wish. 0 - any
sense, 1 - forward sense, -1 - reverse sense
-minscore float If this is greater than or equal to the
maximum score, then any score is permitted
-maxscore float If this is less than or equal to the maximum
score, then any score is permitted
-tag string Tags are the types of extra values that a
feature may have. For example in the EMBL
feature table, a 'CDS' type of feature may
have the tags '/codon', '/codon_start',
'/db_xref', '/EC_number', '/evidence',
'/exception', '/function', '/gene',
'/label', '/map', '/note', '/number',
'/partial', '/product', '/protein_id',
'/pseudo', '/standard_name', '/translation',
'/transl_except', '/transl_table', or
'/usedin'. Some of these tags also have
values, for example '/gene' can have the
value of the gene name.
By default any feature tag in the feature
table is extracted. You can set this to
match any feature tag you wish to show.
The tag may be wildcarded by using '*'.
If you wish to extract more than one tag,
separate their names with the character '|',
eg:
gene | label
-value string Tag values are the values associated with a
feature tag. Tags are the types of extra
values that a feature may have. For example
in the EMBL feature table, a 'CDS' type of
feature may have the tags '/codon',
'/codon_start', '/db_xref', '/EC_number',
'/evidence', '/exception', '/function',
'/gene', '/label', '/map', '/note',
'/number', '/partial', '/product',
'/protein_id', '/pseudo', '/standard_name',
'/translation', '/transl_except',
'/transl_table', or '/usedin'. Only some of
these tags can have values, for example
'/gene' can have the value of the gene name.
By default any feature tag value in the
feature table is shown. You can set this to
match any feature tag valueyou wish to show.
The tag value may be wildcarded by using
'*'.
If you wish to show more than one tag value,
separate their names with a space or the
character '|', eg:
pax* | 10
-join boolean Some features, such as CDS (coding sequence)
and mRNA are composed of introns
concatenated together. There may be other
forms of 'joined' sequence, depending on the
feature table. If this option is set TRUE,
then any group of these features will be
output as a single sequence. If the 'before'
and 'after' qualifiers have been set, then
only the sequence before the first feature
and after the last feature are added.
-featinname boolean To aid you in identifying the type of
feature that has been output, the type of
feature is added to the start of the
description of the output sequence.
Sometimes the description of a sequence is
lost in subsequent processing of the
sequences file, so it is useful for the type
to be a part of the sequence ID name. If
you set this to be TRUE then the name is
added to the ID name of the output sequence.
-describe string To aid you in identifying some further
properties of a feature that has been
output, this lets you specify one or more
tag names that should be added to the output
sequence Description text, together with
their values (if any). For example, if this
is set to be 'gene', then if any output
feature has the tag (for example)
'/gene=BRCA1' associated with it, then the
text '(gene=BRCA1)' will be added to the
Description line. Tags are the types of
extra values that a feature may have. For
example in the EMBL feature table, a 'CDS'
type of feature may have the tags '/codon',
'/codon_start', '/db_xref', '/EC_number',
'/evidence', '/exception', '/function',
'/gene', '/label', '/map', '/note',
'/number', '/partial', '/product',
'/protein_id', '/pseudo', '/standard_name',
'/translation', '/transl_except',
'/transl_table', or '/usedin'. Some of these
tags also have values, for example '/gene'
can have the value of the gene name.
By default no feature tag is displayed. You
can set this to match any feature tag you
wish to show.
The tag may be wildcarded by using '*'.
If you wish to extract more than one tag,
separate their names with the character '|',
eg:
gene | label
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outseq" associated qualifiers
-osformat2 string Output seq format
-osextension2 string File name extension
-osname2 string Base file name
-osdirectory2 string Output directory
-osdbname2 string Database name to add
-ossingle2 boolean Separate file for each entry
-oufo2 string UFO features
-offormat2 string Features format
-ofname2 string Features file name
-ofdirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report deaths
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
| [-outseq] (Parameter 2) |
Output sequence USA | Writeable sequence | <sequence>.format |
| Additional (Optional) qualifiers | Allowed values | Default | |
| -before | If this value is greater than 0 then that number of bases or residues before the feature are included in the extracted sequence. This allows you to get the context of the feature. If this value is negative then the start of the extracted sequence will be this number of bases/residues before the end of the feature. So a value of '10' will start the extraction 10 bases/residues before the start of the sequence, and a value of '-10' will start the extraction 10 bases/residues before the end of the feature. The output sequence will be padded with 'N' or 'X' characters if the sequence starts after the required start of the extraction. | Any integer value | 0 |
| -after | If this value is greater than 0 then that number of bases or residues after the feature are included in the extracted sequence. This allows you to get the context of the feature. If this value is negative then the end of the extracted sequence will be this number of bases/residues after the start of the feature. So a value of '10' will end the extraction 10 bases/residues after the end of the sequence, and a value of '-10' will end the extraction 10 bases/residues after the start of the feature. The output sequence will be padded with 'N' or 'X' characters if the sequence ends before the required end of the extraction. | Any integer value | 0 |
| -source | By default any feature source in the feature table is shown. You can set this to match any feature source you wish to show. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from. The source may be wildcarded by using '*'. If you wish to show more than one source, separate their names with the character '|', eg: gene* | embl | Any string is accepted | * |
| -type | By default every feature in the feature table is extracted. You can set this to be any feature type you wish to extract. See http://www3.ebi.ac.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.expasy.ch/txt/userman.txt for a list of the Swissprot feature types. The type may be wildcarded by using '*'. If you wish to extract more than one type, separate their names with the character '|', eg: *UTR | intron | Any string is accepted | * |
| -sense | By default any feature type in the feature table is extracted. You can set this to match any feature sense you wish. 0 - any sense, 1 - forward sense, -1 - reverse sense | Any integer value | 0 - any sense, 1 - forward sense, -1 - reverse sense |
| -minscore | If this is greater than or equal to the maximum score, then any score is permitted | Any numeric value | 0.0 |
| -maxscore | If this is less than or equal to the maximum score, then any score is permitted | Any numeric value | 0.0 |
| -tag | Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Some of these tags also have values, for example '/gene' can have the value of the gene name. By default any feature tag in the feature table is extracted. You can set this to match any feature tag you wish to show. The tag may be wildcarded by using '*'. If you wish to extract more than one tag, separate their names with the character '|', eg: gene | label | Any string is accepted | * |
| -value | Tag values are the values associated with a feature tag. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Only some of these tags can have values, for example '/gene' can have the value of the gene name. By default any feature tag value in the feature table is shown. You can set this to match any feature tag valueyou wish to show. The tag value may be wildcarded by using '*'. If you wish to show more than one tag value, separate their names with a space or the character '|', eg: pax* | 10 | Any string is accepted | * |
| -join | Some features, such as CDS (coding sequence) and mRNA are composed of introns concatenated together. There may be other forms of 'joined' sequence, depending on the feature table. If this option is set TRUE, then any group of these features will be output as a single sequence. If the 'before' and 'after' qualifiers have been set, then only the sequence before the first feature and after the last feature are added. | Boolean value Yes/No | No |
| -featinname | To aid you in identifying the type of feature that has been output, the type of feature is added to the start of the description of the output sequence. Sometimes the description of a sequence is lost in subsequent processing of the sequences file, so it is useful for the type to be a part of the sequence ID name. If you set this to be TRUE then the name is added to the ID name of the output sequence. | Boolean value Yes/No | No |
| -describe | To aid you in identifying some further properties of a feature that has been output, this lets you specify one or more tag names that should be added to the output sequence Description text, together with their values (if any). For example, if this is set to be 'gene', then if any output feature has the tag (for example) '/gene=BRCA1' associated with it, then the text '(gene=BRCA1)' will be added to the Description line. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Some of these tags also have values, for example '/gene' can have the value of the gene name. By default no feature tag is displayed. You can set this to match any feature tag you wish to show. The tag may be wildcarded by using '*'. If you wish to extract more than one tag, separate their names with the character '|', eg: gene | label | Any string is accepted | An empty string is accepted |
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| (none) | |||
Input file format
extractfeat reads normal sequences with features.Feature tables in Swissprot, EMBL, GFF, etc. format can be added using '-ufo featurefile' on the command line.
Input files for usage example
'tembl:hsfau1' is a sequence entry in the example nucleic acid database 'tembl'
Database entry: tembl:hsfau1
ID HSFAU1 standard; DNA; HUM; 2016 BP.
XX
AC X65921; S45242;
XX
SV X65921.1
XX
DT 13-MAY-1992 (Rel. 31, Created)
DT 21-JUL-1993 (Rel. 36, Last updated, Version 5)
XX
DE H.sapiens fau 1 gene
XX
KW fau 1 gene.
XX
OS Homo sapiens (human)
OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC Eutheria; Primates; Catarrhini; Hominidae; Homo.
XX
RN [1]
RP 1-2016
RA Kas K.;
RT ;
RL Submitted (29-APR-1992) to the EMBL/GenBank/DDBJ databases.
RL K. Kas, University of Antwerp, Dept of Biochemistry T3.22,
RL Universiteitsplein 1, 2610 Wilrijk, BELGIUM
XX
RN [2]
RP 1-2016
RX MEDLINE; 92412144.
RA Kas K., Michiels L., Merregaert J.;
RT "Genomic structure and expression of the human fau gene: encoding the
RT ribosomal protein S30 fused to a ubiquitin-like protein.";
RL Biochem. Biophys. Res. Commun. 187:927-933(1992).
XX
DR SWISS-PROT; P35544; UBIM_HUMAN.
DR SWISS-PROT; Q05472; RS30_HUMAN.
XX
FH Key Location/Qualifiers
FH
FT source 1..2016
FT /db_xref="taxon:9606"
FT /organism="Homo sapiens"
FT /clone_lib="CML cosmid"
FT /clone="15.1"
FT mRNA join(408..504,774..856,951..1095,1557..1612,1787..>1912)
FT /gene="fau 1"
FT exon 408..504
FT /number=1
FT intron 505..773
FT /number=1
FT exon 774..856
[Part of this file has been deleted for brevity]
FT RAKRRMQYNRRFVNVVPTFGKKKGPNANS"
FT intron 857..950
FT /number=2
FT exon 951..1095
FT /number=3
FT intron 1096..1556
FT /number=3
FT exon 1557..1612
FT /number=4
FT intron 1613..1786
FT /number=4
FT exon 1787..>1912
FT /number=5
FT polyA_signal 1938..1943
XX
SQ Sequence 2016 BP; 421 A; 562 C; 538 G; 495 T; 0 other;
ctaccatttt ccctctcgat tctatatgta cactcgggac aagttctcct gatcgaaaac 60
ggcaaaacta aggccccaag taggaatgcc ttagttttcg gggttaacaa tgattaacac 120
tgagcctcac acccacgcga tgccctcagc tcctcgctca gcgctctcac caacagccgt 180
agcccgcagc cccgctggac accggttctc catccccgca gcgtagcccg gaacatggta 240
gctgccatct ttacctgcta cgccagcctt ctgtgcgcgc aactgtctgg tcccgccccg 300
tcctgcgcga gctgctgccc aggcaggttc gccggtgcga gcgtaaaggg gcggagctag 360
gactgccttg ggcggtacaa atagcaggga accgcgcggt cgctcagcag tgacgtgaca 420
cgcagcccac ggtctgtact gacgcgccct cgcttcttcc tctttctcga ctccatcttc 480
gcggtagctg ggaccgccgt tcaggtaaga atggggcctt ggctggatcc gaagggcttg 540
tagcaggttg gctgcggggt cagaaggcgc ggggggaacc gaagaacggg gcctgctccg 600
tggccctgct ccagtcccta tccgaactcc ttgggaggca ctggccttcc gcacgtgagc 660
cgccgcgacc accatcccgt cgcgatcgtt tctggaccgc tttccactcc caaatctcct 720
ttatcccaga gcatttcttg gcttctctta caagccgtct tttctttact cagtcgccaa 780
tatgcagctc tttgtccgcg cccaggagct acacaccttc gaggtgaccg gccaggaaac 840
ggtcgcccag atcaaggtaa ggctgcttgg tgcgccctgg gttccatttt cttgtgctct 900
tcactctcgc ggcccgaggg aacgcttacg agccttatct ttccctgtag gctcatgtag 960
cctcactgga gggcattgcc ccggaagatc aagtcgtgct cctggcaggc gcgcccctgg 1020
aggatgaggc cactctgggc cagtgcgggg tggaggccct gactaccctg gaagtagcag 1080
gccgcatgct tggaggtgag tgagagagga atgttctttg aagtaccggt aagcgtctag 1140
tgagtgtggg gtgcatagtc ctgacagctg agtgtcacac ctatggtaat agagtacttc 1200
tcactgtctt cagttcagag tgattcttcc tgtttacatc cctcatgttg aacacagacg 1260
tccatgggag actgagccag agtgtagttg tatttcagtc acatcacgag atcctagtct 1320
ggttatcagc ttccacacta aaaattaggt cagaccaggc cccaaagtgc tctataaatt 1380
agaagctgga agatcctgaa atgaaactta agatttcaag gtcaaatatc tgcaactttg 1440
ttctcattac ctattgggcg cagcttctct ttaaaggctt gaattgagaa aagaggggtt 1500
ctgctgggtg gcaccttctt gctcttacct gctggtgcct tcctttccca ctacaggtaa 1560
agtccatggt tccctggccc gtgctggaaa agtgagaggt cagactccta aggtgagtga 1620
gagtattagt ggtcatggtg ttaggacttt ttttcctttc acagctaaac caagtccctg 1680
ggctcttact cggtttgcct tctccctccc tggagatgag cctgagggaa gggatgctag 1740
gtgtggaaga caggaaccag ggcctgatta accttccctt ctccaggtgg ccaaacagga 1800
gaagaagaag aagaagacag gtcgggctaa gcggcggatg cagtacaacc ggcgctttgt 1860
caacgttgtg cccacctttg gcaagaagaa gggccccaat gccaactctt aagtcttttg 1920
taattctggc tttctctaat aaaaaagcca cttagttcag tcatcgcatt gtttcatctt 1980
tacttgcaag gcctcaggga gaggtgtgct tctcgg 2016
//
|
Input files for usage example 5
'tsw:*' is a sequence entry in the example protein database 'tsw'
Output file format
The sequences of the specified features are written out.
The ID name of the sequence is formed from the original sequence name with the start and end positions of the feature appended to it. So if the feature came from a sequence with an ID name of 'XYZ' from positions 10 to 22, then the resulting ID name of the feature sequence will be 'XYZ_10_22'
The name of the type of feature is added to the start of the description of the sequence in brackets, e.g.: '[exon]'.
The sequence is written out as a normal sequence.
If the feature is in the reverse sense of a nucleic acid sequence, then it is reverse-complemented before being written.
Data files
None.Notes
If a feature is specified as being a part of a different sequence entry in a database, then this feature is ignored.If you are extracting 'joined' features and one of more of the component features is in a different sequence entry, then the whole joined feature is ignored.
References
None.Warnings
None.Diagnostic Error Messages
If the end position of the sequence to be written is less than the start position, then the warning message "Extraction region end less than start for feature type [start-end] in ID name" is written and no sequence is output.Exit status
It always exits with status 0.Known bugs
None.See also
| Program name | Description |
|---|---|
| biosed | Replace or delete sequence sections |
| codcopy | Reads and writes a codon usage table |
| coderet | Extract CDS, mRNA and translations from feature tables |
| cutseq | Removes a specified section from a sequence |
| degapseq | Removes gap characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Reads and writes (returns) flatfile entries |
| extractseq | Extract regions from a sequence |
| listor | Write a list file of the logical OR of two sets of sequences |
| maskfeat | Mask off features of a sequence |
| maskseq | Mask off regions of a sequence |
| newseq | Type in a short new sequence |
| noreturn | Removes carriage return from ASCII files |
| notseq | Exclude a set of sequences and write out the remaining ones |
| nthseq | Writes one sequence from a multiple set of sequences |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsplit | Reads and writes (returns) sequences in individual files |
| showfeat | Show features of a sequence |
| skipseq | Reads and writes (returns) sequences, skipping first few |
| splitter | Split a sequence into (overlapping) smaller sequences |
| trimest | Trim poly-A tails off EST sequences |
| trimseq | Trim ambiguous bits off the ends of sequences |
| twofeat | Finds neighbouring pairs of features in sequences |
| union | Reads sequence fragments and builds one sequence |
| vectorstrip | Strips out DNA between a pair of vector sequences |
| yank | Reads a sequence range, appends the full USA to a list file |
Author(s)
Gary Williams (gwilliam © rfcgr.mrc.ac.uk)MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK
History
Written (Dec 12 2001) - Gary WilliamsAdded '-join' parameter (June 2002) - Gary Williams