degapseq

 

Function

Removes gap characters from sequences

Description

degapseq reads in one or more sequences and writes them out again minus any gap characters. In effect it removes gaps from aligned sequences.

In fact, if does more than just this as it removes ANY non-alphabetic character from the input sequence, so as well as removing the gap-characters, it will remove such things as the '*' in protein sequences that indicates the position of a 'translated' STOP codon.

There are many different formats for storing sequences in files. Some sequence formats allow you to store aligned sequences, including the information on where gaps have been introduced to make the sequence align properly. This is indicated by using a special character to indicate that there is a gap at that position. Different sequence formats use different characters to indicate gaps. Some formats may use more than one type of character to indicate different types of gaps (e.g. gaps at the ends of the sequences, internal gaps, gaps introduced by a program or by a person editing the alignment, etc.) Some typicate characters used to indicate where gaps are may be: '.', '-' and '~'.

When EMBOSS programs read in a sequence that has gap-characters in, all gap characters are internally changed to '-' characters. i.e. EMBOSS only has one type of gap character. Thus any distinguishing characters for different gap types are reduced to a '-'. There is only one type of gap in EMBOSS.

degapseq removes any non-alphabetic character in the sequence, in effect this means that gaps and '*' characters are removed. The sequence is then written out.

Usage

Here is a sample session with degapseq

% degapseq dnagap.fasta nogaps.seq 
Removes gap characters from sequences

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Sequence database USA
  [-outseq]            seqoutall  Output sequence(s) USA

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1             integer    Start of each sequence to be used
   -send1               integer    End of each sequence to be used
   -sreverse1           boolean    Reverse (if DNA)
   -sask1               boolean    Ask for begin/end/reverse
   -snucleotide1        boolean    Sequence is nucleotide
   -sprotein1           boolean    Sequence is protein
   -slower1             boolean    Make lower case
   -supper1             boolean    Make upper case
   -sformat1            string     Input sequence format
   -sdbname1            string     Database name
   -sid1                string     Entryname
   -ufo1                string     UFO features
   -fformat1            string     Features format
   -fopenfile1          string     Features file name

   "-outseq" associated qualifiers
   -osformat2           string     Output seq format
   -osextension2        string     File name extension
   -osname2             string     Base file name
   -osdirectory2        string     Output directory
   -osdbname2           string     Database name to add
   -ossingle2           boolean    Separate file for each entry
   -oufo2               string     UFO features
   -offormat2           string     Features format
   -ofname2             string     Features file name
   -ofdirectory2        string     Output directory

   General qualifiers:
   -auto                boolean    Turn off prompts
   -stdout              boolean    Write standard output
   -filter              boolean    Read standard input, write standard output
   -options             boolean    Prompt for standard and additional values
   -debug               boolean    Write debug output to program.dbg
   -verbose             boolean    Report some/full command line options
   -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning             boolean    Report warnings
   -error               boolean    Report errors
   -fatal               boolean    Report fatal errors
   -die                 boolean    Report deaths


Standard (Mandatory) qualifiers Allowed values Default
[-sequence]
(Parameter 1)
Sequence database USA Readable sequence(s) Required
[-outseq]
(Parameter 2)
Output sequence(s) USA Writeable sequence(s) <sequence>.format
Additional (Optional) qualifiers Allowed values Default
(none)
Advanced (Unprompted) qualifiers Allowed values Default
(none)

Input file format

Any valid input sequence USA is allowed.

The input sequence can be nucleic or protein.

The input sequence can be gapped or ungapped.

Input files for usage example

File: dnagap.fasta

>FASTA F10002 FASTA FORMAT DNA SEQUENCE
ACGT....ACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGT

Output file format

The output is a sequence with no gaps.

Output files for usage example

File: nogaps.seq

>FASTA F10002 FASTA FORMAT DNA SEQUENCE
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGT

Data files

None.

Notes

None.

References

None.

Warnings

It will remove '*' characters from protein sequences as well as removing the gap characters.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program nameDescription
biosedReplace or delete sequence sections
codcopyReads and writes a codon usage table
cutseqRemoves a specified section from a sequence
descseqAlter the name or description of a sequence
entretReads and writes (returns) flatfile entries
extractfeatExtract features from a sequence
extractseqExtract regions from a sequence
listorWrite a list file of the logical OR of two sets of sequences
maskfeatMask off features of a sequence
maskseqMask off regions of a sequence
newseqType in a short new sequence
noreturnRemoves carriage return from ASCII files
notseqExclude a set of sequences and write out the remaining ones
nthseqWrites one sequence from a multiple set of sequences
pasteseqInsert one sequence into another
revseqReverse and complement a sequence
seqretReads and writes (returns) sequences
seqretsplitReads and writes (returns) sequences in individual files
skipseqReads and writes (returns) sequences, skipping first few
splitterSplit a sequence into (overlapping) smaller sequences
trimestTrim poly-A tails off EST sequences
trimseqTrim ambiguous bits off the ends of sequences
unionReads sequence fragments and builds one sequence
vectorstripStrips out DNA between a pair of vector sequences
yankReads a sequence range, appends the full USA to a list file

Author(s)

Gary Williams (gwilliam © rfcgr.mrc.ac.uk)
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

History

Written (6 March 2001) - Gary Williams

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None