|
union |
Function
Reads sequence fragments and builds one sequenceDescription
union reads in several sequences, concatenates them and writes them out as a single sequence.It is most useful when the input sequences are specified in a List file. The List file (file of sequence names) can be any set of sequences in files or database entries specified in the normal EMBOSS USA (which can include the spcification of sub-regions of the sequence, eg. 'em:hsfau[20,55]'). Specifying several such subregions in a sequence or sequences allows you to enter disjoint sequences to be joined.
Usage
Here is a sample session with unionthe file 'cds.list' contains a list of the regions making up the coding sequence of 'embl:hsfau':
% union Reads sequence fragments and builds one sequence Input sequence(s): @cds.list Output sequence [hsfau1.fasta]: |
Go to the input files for this example
Go to the output files for this example
Command line arguments
Standard (Mandatory) qualifiers:
[-sequence] seqall Sequence database USA
[-outseq] seqout Output sequence USA
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outseq" associated qualifiers
-osformat2 string Output seq format
-osextension2 string File name extension
-osname2 string Base file name
-osdirectory2 string Output directory
-osdbname2 string Database name to add
-ossingle2 boolean Separate file for each entry
-oufo2 string UFO features
-offormat2 string Features format
-ofname2 string Features file name
-ofdirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report deaths
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
| [-outseq] (Parameter 2) |
Output sequence USA | Writeable sequence | <sequence>.format |
| Additional (Optional) qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| (none) | |||
Input file format
The input can be any set of sequences in a file of multiple sequence entries or in a List file. The sequences are concatenated in the order in which they appear in the file.Input files for usage example
File: cds.list
tembl-id:HSFAU1[782:856] tembl-id:HSFAU1[951:1095] tembl-id:HSFAU1[1557:1612] tembl-id:HSFAU1[1787:1912] |
You may find the program yank useful for creating List files.
Output file format
Output files for usage example
File: hsfau1.fasta
>HSFAU1 X65921.1 H.sapiens fau 1 gene atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg cccacctttggcaagaagaagggccccaatgccaactcttaa |
The result is a normal sequence file containing a single sequence resulting from the concatenation of the input sequences.
Data files
None.Notes
None.References
None.Warnings
None.Diagnostic Error Messages
None.Exit status
It always exits with status 0.Known bugs
None.See also
| Program name | Description |
|---|---|
| biosed | Replace or delete sequence sections |
| codcopy | Reads and writes a codon usage table |
| cutseq | Removes a specified section from a sequence |
| degapseq | Removes gap characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Reads and writes (returns) flatfile entries |
| extractfeat | Extract features from a sequence |
| extractseq | Extract regions from a sequence |
| listor | Write a list file of the logical OR of two sets of sequences |
| maskfeat | Mask off features of a sequence |
| maskseq | Mask off regions of a sequence |
| newseq | Type in a short new sequence |
| noreturn | Removes carriage return from ASCII files |
| notseq | Exclude a set of sequences and write out the remaining ones |
| nthseq | Writes one sequence from a multiple set of sequences |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsplit | Reads and writes (returns) sequences in individual files |
| skipseq | Reads and writes (returns) sequences, skipping first few |
| splitter | Split a sequence into (overlapping) smaller sequences |
| trimest | Trim poly-A tails off EST sequences |
| trimseq | Trim ambiguous bits off the ends of sequences |
| vectorstrip | Strips out DNA between a pair of vector sequences |
| yank | Reads a sequence range, appends the full USA to a list file |
You may find the program yank useful for creating List files.
Author(s)
Peter Rice (pmr © ebi.ac.uk)Informatics Division, European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK