|
supermatcher |
Function
Match large sequences against one or more other sequencesDescription
This is a rough and ready local alignment program for large sequences. The reason it is rough and ready is that wordmatch is used to find all the word matches between the first sequence and another sequence. Then by calculating the highest score for a diagonal we can then use this as the centre point for a Smith-Waterman type calculation of a width given by the user. So a narrow diagonal Smith-Waterman is calculated hence the results will be rough but due to the space saving much larger sequences can be aligned.Usage
Here is a sample session with supermatcher
% supermatcher tembl:ec* tembl:eclac -word 50 Match large sequences against one or more other sequences Gap opening penalty [10.0]: Gap extension penalty [0.5]: 3.0 Output alignment [eclac.supermatcher]: |
Go to the input files for this example
Go to the output files for this example
Command line arguments
Standard (Mandatory) qualifiers:
[-asequence] seqall Sequence database USA
[-bsequence] seqset Sequence set USA
-gapopen float Gap opening penalty
-gapextend float Gap extension penalty
[-outfile] align Output alignment file name
Additional (Optional) qualifiers:
-datafile matrixf This is the scoring matrix file used when
comparing sequences. By default it is the
file 'EBLOSUM62' (for proteins) or the file
'EDNAFULL' (for nucleic sequences). These
files are found in the 'data' directory of
the EMBOSS installation.
-width integer Alignment width
-wordlen integer Word length for initial matching
-errorfile outfile Error file to be written to
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-asequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-bsequence" associated qualifiers
-sbegin2 integer Start of each sequence to be used
-send2 integer End of each sequence to be used
-sreverse2 boolean Reverse (if DNA)
-sask2 boolean Ask for begin/end/reverse
-snucleotide2 boolean Sequence is nucleotide
-sprotein2 boolean Sequence is protein
-slower2 boolean Make lower case
-supper2 boolean Make upper case
-sformat2 string Input sequence format
-sdbname2 string Database name
-sid2 string Entryname
-ufo2 string UFO features
-fformat2 string Features format
-fopenfile2 string Features file name
"-outfile" associated qualifiers
-aformat3 string Alignment format
-aextension3 string File name extension
-adirectory3 string Output directory
-aname3 string Base file name
-awidth3 integer Alignment width
-aaccshow3 boolean Show accession number in the header
-adesshow3 boolean Show description in the header
-ausashow3 boolean Show the full USA in the alignment
-aglobal3 boolean Show the full sequence in alignment
"-errorfile" associated qualifiers
-odirectory string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report deaths
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-asequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
| [-bsequence] (Parameter 2) |
Sequence set USA | Readable set of sequences | Required |
| -gapopen | Gap opening penalty | Number from 0.000 to 100.000 | 10.0 for any sequence type |
| -gapextend | Gap extension penalty | Number from 0.000 to 10.000 | 0.5 for any sequence type |
| [-outfile] (Parameter 3) |
Output alignment file name | Alignment output file | |
| Additional (Optional) qualifiers | Allowed values | Default | |
| -datafile | This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation. | Comparison matrix file in EMBOSS data path | EBLOSUM62 for protein EDNAFULL for DNA |
| -width | Alignment width | Integer 1 or more | 16 |
| -wordlen | Word length for initial matching | Integer 3 or more | 6 |
| -errorfile | Error file to be written to | Output file | supermatcher.error |
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| (none) | |||
Input file format
supermatcher reads two sequence USAs of the same type. They must both be protein or both be nucleic acid sequences.Input files for usage example
'tembl:ec*' is a sequence entry in the example nucleic acid database 'tembl'
Database entry: tembl:eclac
ID ECLAC standard; DNA; PRO; 7477 BP.
XX
AC J01636; J01637; K01483; K01793;
XX
SV J01636.1
XX
DT 30-NOV-1990 (Rel. 26, Created)
DT 04-MAR-2000 (Rel. 63, Last updated, Version 7)
XX
DE E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
XX
KW acetyltransferase; beta-D-galactosidase; galactosidase; lac operon;
KW lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene;
KW lacZ gene; mutagenesis; palindrome; promoter region;
KW thiogalactoside acetyltransferase.
XX
OS Escherichia coli
OC Bacteria; Proteobacteria; gamma subdivision; Enterobacteriaceae;
OC Escherichia.
XX
RN [1]
RP 1243-1266
RX MEDLINE; 74055539.
RA Gilbert W., Maxam A.;
RT "The nucleotide sequence of the lac operator";
RL Proc. Natl. Acad. Sci. U.S.A. 70:3581-3584(1973).
XX
RN [2]
RP 1246-1308
RX MEDLINE; 74055540.
RA Maizels N.M.;
RT "The nucleotide sequence of the lactose messenger ribonucleic acid
RT transcribed from the UV5 promoter mutant of Escherichia coli";
RL Proc. Natl. Acad. Sci. U.S.A. 70:3585-3589(1973).
XX
RN [3]
RX MEDLINE; 74174501.
RA Gilbert W., Maizels N., Maxam A.;
RT "Sequences of controlling regions of the lactose operon";
RL Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974).
XX
RN [4]
RA Gilbert W., Gralla J., Majors A.J., Maxam A.;
RT "Lactose operator sequences and the action of lac repressor";
RL (in) Sund H., Blauer G. (eds.);
RL PROTEIN-LIGAND INTERACTIONS:193-207;
RL Walter de Gruyter, New York (1975)
XX
RN [5]
RP 1146-1282
[Part of this file has been deleted for brevity]
cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg 4560
ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg 4620
ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct 4680
ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg 4740
gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga 4800
aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct 4860
gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct 4920
ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg 4980
cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta 5040
agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg 5100
gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct 5160
ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac 5220
ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg 5280
ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct 5340
cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg 5400
tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc 5460
tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca 5520
atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg 5580
gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc 5640
gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac 5700
caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag 5760
gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt 5820
taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta 5880
aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt 5940
acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg 6000
atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg 6060
ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga 6120
taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca 6180
tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg 6240
tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact 6300
attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg 6360
ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa 6420
gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt 6480
gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc 6540
atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg 6600
atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca 6660
gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac 6720
accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc 6780
agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca 6840
ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg 6900
tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg 6960
taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc 7020
acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac 7080
caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg 7140
tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca 7200
gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca 7260
ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag 7320
cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag 7380
actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc 7440
cagcccgccc atggtaacca ccggcagagc ggtcgac 7477
//
|
Output file format
The output is a standard EMBOSS alignment file.
The results can be output in one of several styles by using the command-line qualifier -aformat xxx, where 'xxx' is replaced by the name of the required format. Some of the alignment formats can cope with an unlimited number of sequences, while others are only for pairs of sequences.
The available multiple alignment format names are: unknown, multiple, simple, fasta, msf, trace, srs
The available pairwise alignment format names are: pair, markx0, markx1, markx2, markx3, markx10, srspair, score
See: http://emboss.sf.net/docs/themes/AlignFormats.html for further information on alignment formats.
The output alignment is in simple format by default.
Output files for usage example
File: supermatcher.error
|
|
File: eclac.supermatcher
########################################
# Program: supermatcher
# Rundate: Fri Jul 15 2005 12:00:00
# Align_format: simple
# Report_file: eclac.supermatcher
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: ECLAC
# 2: ECLAC
# Matrix: EDNAFULL
# Gap_penalty: 10.0
# Extend_penalty: 3.0
#
# Length: 7477
# Identity: 7477/7477 (100.0%)
# Similarity: 7477/7477 (100.0%)
# Gaps: 0/7477 ( 0.0%)
# Score: 37385.0
#
#
#=======================================
ECLAC 1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc 50
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 1 gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgccc 50
ECLAC 51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg 100
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 51 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacg 100
ECLAC 101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg 150
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 101 atgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtg 150
ECLAC 151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc 200
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 151 aaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggc 200
ECLAC 201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg 250
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 201 gatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgg 250
ECLAC 251 gcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcac 300
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 251 gcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcac 300
ECLAC 301 gcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactggg 350
[Part of this file has been deleted for brevity]
ECLACZ 2501 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt 2550
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 3787 tgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt 3836
ECLACZ 2551 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac 2600
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 3837 atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattac 3886
ECLACZ 2601 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc 2650
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 3887 cgttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcc 3936
ECLACZ 2651 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta 2700
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 3937 tgaactgccagctggcgcaggtagcagagcgggtaaactggctcggatta 3986
ECLACZ 2701 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg 2750
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 3987 gggccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccg 4036
ECLACZ 2751 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg 2800
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 4037 ctgggatctgccattgtcagacatgtataccccgtacgtcttcccgagcg 4086
ECLACZ 2801 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag 2850
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 4087 aaaacggtctgcgctgcgggacgcgcgaattgaattatggcccacaccag 4136
ECLACZ 2851 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact 2900
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 4137 tggcgcggcgacttccagttcaacatcagccgctacagtcaacagcaact 4186
ECLACZ 2901 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc 2950
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 4187 gatggaaaccagccatcgccatctgctgcacgcggaagaaggcacatggc 4236
ECLACZ 2951 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc 3000
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 4237 tgaatatcgacggtttccatatggggattggtggcgacgactcctggagc 4286
ECLACZ 3001 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca 3050
||||||||||||||||||||||||||||||||||||||||||||||||||
ECLAC 4287 ccgtcagtatcggcggaattccagctgagcgccggtcgctaccattacca 4336
ECLACZ 3051 gttggtctggtgtcaaaaataataataa 3078
||||||||||||||||||||||||||||
ECLAC 4337 gttggtctggtgtcaaaaataataataa 4364
#---------------------------------------
#---------------------------------------
|
The file 'supermatcher.error' will contain any errors that occured during the program. This may be that wordmatch could not find any matches hence no suitable start point is found for the smith-waterman calculation.
Data files
For protein sequences EBLOSUM62 is used for the substitution matrix. For nucleotide sequence, EDNAMAT is used. Others can be specified.
EMBOSS data files are distributed with the application and stored in the standard EMBOSS data directory, which is defined by the EMBOSS environment variable EMBOSS_DATA.
To see the available EMBOSS data files, run:
% embossdata -showall
To fetch one of the data files (for example 'Exxx.dat') into your current directory for you to inspect or modify, run:
% embossdata -fetch -file Exxx.dat
Users can provide their own data files in their own directories. Project specific files can be put in the current directory, or for tidier directory listings in a subdirectory called ".embossdata". Files for all EMBOSS runs can be put in the user's home directory, or again in a subdirectory called ".embossdata".
The directories are searched in the following order:
- . (your current directory)
- .embossdata (under your current directory)
- ~/ (your home directory)
- ~/.embossdata
Notes
The time this program takes to do an alignment depends very much on the word size. For short sequences a short word size (e.g. 4) can make it take a very long time. Large word sizes (e.g. 30) for sequences that are very similar give a very quick result. The default of 16 should give reasonable fast alignments.Because it does a Smith & Waterman alignment (albeit in a narrow region around the diagonal shown to be the 'best' by a word match), this program can use huge amounts of memory if the sequences are large.
Because the alignment is made within a narrow area each side of the 'best' diagonal, if there are sufficient indels between the two sequences, then the path of the Smith & Waterman alignment can wander outside of this area. Making the width larger can avoid this problem, but you then use more memory.
The longer the sequences and the wider the specified alignment width, the more memory will be used.
If the program terminates due to lack of memory you can try the following:
Run the UNIX command 'limit' to see if your stack or memory usage have been limited and if so, run 'unlimit', (e.g.: '% unlimit stacksize').
References
None.Warnings
None.Diagnostic Error Messages
None.Exit status
It always exits with a status of 0.Known bugs
None.See also
| Program name | Description |
|---|---|
| matcher | Finds the best local alignments between two sequences |
| seqmatchall | All-against-all comparison of a set of sequences |
| water | Smith-Waterman local alignment |
| wordmatch | Finds all exact matches of a given size between 2 sequences |
Author(s)
Ian Longden (il © sanger.ac.uk)Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK.