|
|
msbar |
It can act on the following sizes of sequence:
If the sequence is nucleic, the codon and block-sized operations can optionally be done in-frame. This causes the minimum block size to be set to 3 and the randomly chosen positions to be multiples of 3.
For each of the above size of sequence it can produce the effects of any of the following types of mutation at a randomly chosen position:
The input and output sequences may not differ if only a few changes are chosen as (for example) one in four nucleic acid point substitutions will not change the sequence.
N.B. There is no selection of the types of mutation to produce viable sequence as there would be in a real organism. In particular, there is no attempt to bias mutations of nucleic acid sequences to conform to the C+G ratio in the sequence or to bias the codons in the direction of the frequencies used in the organism. This program emulates mutation, not selection.
This program was named from the acronym of "Mutate Sequence Beyond All Recognition", by analogy with the acronym "fubar" commonly used in the US and UK armed forces.
This asks for 5 mutations, with point mutations as changes (substitutions), and the codon and block mutations ignored.
% msbar
Mutate sequence beyond all recognition
Input sequence(s): tembl:eclac
Number of times to perform the mutation operations [1]: 5
Point mutation operations
0 : None
1 : Any of the following
2 : Insertions
3 : Deletions
4 : Changes
5 : Duplications
6 : Moves
Types of point mutations to perform [0]: 4
Block mutation operations
0 : None
1 : Any of the following
2 : Insertions
3 : Deletions
4 : Changes
5 : Duplications
6 : Moves
Types of block mutations to perform [0]:
Codon mutation operations
0 : None
1 : Any of the following
2 : Insertions
3 : Deletions
4 : Changes
5 : Duplications
6 : Moves
Types of codon mutations to perform [0]:
Output sequence [eclac.fasta]:
|
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers (* if not always prompted):
[-sequence] seqall Sequence database USA
-count integer Number of times to perform the mutation
operations
-point menu Types of point mutations to perform
-block menu Types of block mutations to perform
* -codon menu Types of codon mutations to perform. These
are only done if the sequence is nucleic.
[-outseq] seqoutall Output sequence(s) USA
Additional (Optional) qualifiers (* if not always prompted):
* -inframe boolean Do 'codon' and 'block' operations in frame
Advanced (Unprompted) qualifiers:
-othersequence seqall If you require that the resulting mutated
sequence should not match a set of other
sequences, then you can specify that set of
sequences here. For example, if you require
that the mutated sequence should not be the
same as the input sequence, enter the input
sequence here. If you want the result to be
different to previous results of this
program, specify the previous result
sequences here. The program will check that
the result does not match the sequences
specified here before writing it out. If a
match is found, then the mutation is started
again with a fresh copy of the input
sequence. If, after 10 such retries, there
is still a match to the set of sequence
given here, then the matching mutated
sequence is written with a warning message.
-minimum integer Minimum size for a block mutation
-maximum integer Maximum size for a block mutation
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-othersequence" associated qualifiers
-sbegin integer Start of each sequence to be used
-send integer End of each sequence to be used
-sreverse boolean Reverse (if DNA)
-sask boolean Ask for begin/end/reverse
-snucleotide boolean Sequence is nucleotide
-sprotein boolean Sequence is protein
-slower boolean Make lower case
-supper boolean Make upper case
-sformat string Input sequence format
-sdbname string Database name
-sid string Entryname
-ufo string UFO features
-fformat string Features format
-fopenfile string Features file name
"-outseq" associated qualifiers
-osformat2 string Output seq format
-osextension2 string File name extension
-osname2 string Base file name
-osdirectory2 string Output directory
-osdbname2 string Database name to add
-ossingle2 boolean Separate file for each entry
-oufo2 string UFO features
-offormat2 string Features format
-ofname2 string Features file name
-ofdirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report deaths
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| [-sequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required | ||||||||||||||
| -count | Number of times to perform the mutation operations | Integer 0 or more | 1 | ||||||||||||||
| -point | Types of point mutations to perform |
|
0 | ||||||||||||||
| -block | Types of block mutations to perform |
|
0 | ||||||||||||||
| -codon | Types of codon mutations to perform. These are only done if the sequence is nucleic. |
|
0 | ||||||||||||||
| [-outseq] (Parameter 2) |
Output sequence(s) USA | Writeable sequence(s) | <sequence>.format | ||||||||||||||
| Additional (Optional) qualifiers | Allowed values | Default | |||||||||||||||
| -inframe | Do 'codon' and 'block' operations in frame | Boolean value Yes/No | No | ||||||||||||||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |||||||||||||||
| -othersequence | If you require that the resulting mutated sequence should not match a set of other sequences, then you can specify that set of sequences here. For example, if you require that the mutated sequence should not be the same as the input sequence, enter the input sequence here. If you want the result to be different to previous results of this program, specify the previous result sequences here. The program will check that the result does not match the sequences specified here before writing it out. If a match is found, then the mutation is started again with a fresh copy of the input sequence. If, after 10 such retries, there is still a match to the set of sequence given here, then the matching mutated sequence is written with a warning message. | Readable sequence(s) | asis:N | ||||||||||||||
| -minimum | Minimum size for a block mutation | Integer 0 or more | 1 | ||||||||||||||
| -maximum | Maximum size for a block mutation | Any integer value | 10 | ||||||||||||||
ID ECLAC standard; DNA; PRO; 7477 BP.
XX
AC J01636; J01637; K01483; K01793;
XX
SV J01636.1
XX
DT 30-NOV-1990 (Rel. 26, Created)
DT 04-MAR-2000 (Rel. 63, Last updated, Version 7)
XX
DE E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
XX
KW acetyltransferase; beta-D-galactosidase; galactosidase; lac operon;
KW lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene;
KW lacZ gene; mutagenesis; palindrome; promoter region;
KW thiogalactoside acetyltransferase.
XX
OS Escherichia coli
OC Bacteria; Proteobacteria; gamma subdivision; Enterobacteriaceae;
OC Escherichia.
XX
RN [1]
RP 1243-1266
RX MEDLINE; 74055539.
RA Gilbert W., Maxam A.;
RT "The nucleotide sequence of the lac operator";
RL Proc. Natl. Acad. Sci. U.S.A. 70:3581-3584(1973).
XX
RN [2]
RP 1246-1308
RX MEDLINE; 74055540.
RA Maizels N.M.;
RT "The nucleotide sequence of the lactose messenger ribonucleic acid
RT transcribed from the UV5 promoter mutant of Escherichia coli";
RL Proc. Natl. Acad. Sci. U.S.A. 70:3585-3589(1973).
XX
RN [3]
RX MEDLINE; 74174501.
RA Gilbert W., Maizels N., Maxam A.;
RT "Sequences of controlling regions of the lactose operon";
RL Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974).
XX
RN [4]
RA Gilbert W., Gralla J., Majors A.J., Maxam A.;
RT "Lactose operator sequences and the action of lac repressor";
RL (in) Sund H., Blauer G. (eds.);
RL PROTEIN-LIGAND INTERACTIONS:193-207;
RL Walter de Gruyter, New York (1975)
XX
RN [5]
RP 1146-1282
[Part of this file has been deleted for brevity]
cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg 4560
ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg 4620
ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct 4680
ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg 4740
gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga 4800
aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct 4860
gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct 4920
ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg 4980
cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta 5040
agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg 5100
gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct 5160
ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac 5220
ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg 5280
ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct 5340
cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg 5400
tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc 5460
tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca 5520
atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg 5580
gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc 5640
gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac 5700
caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag 5760
gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt 5820
taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta 5880
aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt 5940
acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg 6000
atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg 6060
ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga 6120
taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca 6180
tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg 6240
tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact 6300
attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg 6360
ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa 6420
gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt 6480
gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc 6540
atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg 6600
atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca 6660
gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac 6720
accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc 6780
agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca 6840
ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg 6900
tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg 6960
taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc 7020
acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac 7080
caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg 7140
tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca 7200
gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca 7260
ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag 7320
cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag 7380
actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc 7440
cagcccgccc atggtaacca ccggcagagc ggtcgac 7477
//
|
>ECLAC J01636.1 E.coli lactose operon with lacI, lacZ, lacY and lacA genes. gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt caattcagggtggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggt gtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacg cgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaa caactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcac gcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtg gtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatctt ctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccatt gctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagaca cccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctg gtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcg cgtctgcgtctggctggctggcataaatTtctcactcgcaatcaaattcagccgatagcg gaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaat gagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatg cgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgac gataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaacaggattttcgc ctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaag ggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacg caaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcc cgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggc accccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggata acaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcgttttac aacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatcccc ctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgc gcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaa gctggctggagtgcgatcttcctgaggccgatactgtcgtcgtcccctcaaactggcaga tgcacggttacgatgcgcccatctacaccaacgtaacctatcccattacggtcaatccgc cgtttgttcccacggagaatccgacgggttgttactcgctcacatttaatgttgatgaaa gctggctacaggaaggccagacgcgaattatttttgatggcgttaactcggcgtttcatc tgtggtgcaacgggcgctgggtcggttacggccaggacagtcgtttgccgtctgaatttg acctgagcgcatttttacgcgccggagaaaaccgcctcgcggtgatggtgctgcgttgga gtgacggcagttatctggaagatcaggatatgtggcggatgagcggcattttccgtgacg tctcgttgctgcataaaccgactacacaaatcagcgatttccatgttgccactcgcttta atgatgatttcagccgcgctgtactggaggctgaagttcagatgtgcggcgagttgcgtg actacctacgggtaacagtttctttatggcagggtgaaacgcaggtcgccagcggcaccg cgcctttcggcggtgaaattatcgatgagcgtggtggttatgccgatcgcgtcacactac gtctgaacgtcgaaaacccgaaactgtggagcgccgaaatcccgaatctctatcgtgcgg tggttgaactgcacaccgccgacggcacgctgattgaagcagaagcctgcgatgtcggtt tccgcgaggtgcggattgaaaatggtctgctgctgctgaacggcaagccgttgctgattc gaggcgttaaccgtcacgagcatcatcctctgcatggtcaggtcatggatgagcagacga tggtgcaggatatcctgctgatgaagcagaacaactttaacgccgtgcgctgttcgcatt atccgaaccatccgctgtggtacacgctgtgcgaccgctacggcctgtatgtggtggatg aagccaatattgaaacccacggcatggtgccaatgaatcgtctgaccgatgatccgcgct ggctaccggcgatgagcgaacgcgtaacgcgaatggtgcagcgcgatcgtaatcacccga gtgtgatcatctggtcgctggggaatgaatcaggccacggcgctaatcacgacgcgctgt atcgctggatcaaatctgtcgatccttcccgcccggtgcagtatgaaggcggcggagccg acaccacggccaccgatattatttgcccgatgtacgcgcgcgtggatgaagaccagccct tcccggctgtgccgaaatggtccatcaaaaaatggctttcgctacctggagagacgcgcc cgctgatcctttgcgaatacgcccacgcgatgggtaacagtcttggcggtttcgctaaat [Part of this file has been deleted for brevity] tgttcggtttattctttttcttttacttttttatcatgggagcctacttcccgtttttcc cgatttggctacatgacatcaaccatatcagcaaaagtgatacgggtattatttttgccg ctatttctctgttctcgctattattccaaccgctgtttggtctgctttctgacaaactcg ggctgcgcaaatacctgctgtggattattaccggcatgttagtgatgtttgcgccgttct ttatttttatcttcgggccactgttacaatacaacattttagtaggatcgattgttggtg gtatttatctaggcttttgttttaacgccggtgcgccagcagtagaggcatttattgaga aagtcagccgtcgcagtaatttcgaatttggtcgcgcgcggatgtttggctgtgttggct gggcgctgtgtgccTcgattgtcggcatcatgttcaccatcaataatcagtttgttttct ggctgggctctggctgtgcactcatcctcgccgttttactctttttcgccaaaacggatg cgccctcttctgccacggttgccaatgcggtaggtgccaaccattcggcatttagcctta agctggcactggaactgttcagacagccaaaactgtggtttttgtcactgtatgttattg gcgtttcctgcacctacgatgtttttgaccaacagtttgctaatttctttacttcgttct ttgctaccggtgaacagggtacgcgggtatttggctacgtaacgacaatgggcgaattac ttaacgcctcgattatgttctttgcgccactgatcattaatcgcatcggtgggaaaaacg ccctgctgctggctggcactattatgtctgtacgtattattggctcatcgttcgccacct cagcgctggaagtggttattctgaaaacgctgcatatgtttgaagtaccgttcctgctgg tgggctgctttaaatatattaccagccagtttgaagtgcgtttttcagcgacgatttatc tggtctgtttctgcttctttaagcaactggcgatgatttttatgtctgtactggcgggca atatgtatgaaagcatcggtttccagggcgcttatctggtgctgggtctggtggcgctgg gcttcaccttaatttccgtgttcacgcttagcggccccggcccgctttccctgctgcgtc gtcaggtgaatgaagtcgcttaagcaatcaatgtcggatgcggcgcgacgcttatccgac caacatatcataacggagtgatcgcattgaacatgccaatgaccgaaagaataagagcag gcaagctatttaccgatatgtgcgaaggcttaccggaaaaaagacttcgtgggaaaacgt taatgtatgagtCtaatcactcgcatccatcagaagttgaaaaaagagaaagcctgatta aagaaatgtttgccacggtaggggaaaacgcctgggCagaaccgcctgtctatttctctt acggttccaacatccatataggccgcaatttttatgcaaatttcaatttaaccattgtcg atgactacacggtaacaatcggtgataacgtactgattgcacccaacgttactctttccg ttacgggacaccctgtacaccatgaattgagaaaaaacggcgagatgtactcttttccga taacgattggcaataacgtctggatcggaagtcatgtggttattaatccaggcgtcacca tcggggataattctgttattggcgcgggtagtatcgtcacaaaagacattccaccaaacg tcgtggcggctggcgttccttgtcgggttattcgcgaaataaacgaccgggataagcact attatttcaaagattataaagttgaatcgtcagtttaaattataaaaattgcctgatacg ctgcgcttatcaggcctacaagttcagcgatctacattagccgcatccggcatgaacaaa gcgcaggaacaagcgtcgcatcatgcctctttgacccacagctgcggaaaacgtactggt gcaaaacgcagggttatgatcatcagcccaacgacgcacagcgcatgaaatgcccagtcc atcaggtaattgccgctgatactacgcagcacgccagaaaaccacggggcaagcccggcg atgataaaaccgattccctgcataaacgccaccagcttgccagcaatagccggttgcaca gagtgatcgagcgccagcagcaaacagagcggaaacgcgccgcccagacctaacccacac accatcgcccacaataccggcaattgcatcggcagccagataaagccgcagaaccccacc agttgtaacaccagcgccagcattaacagtttgcgccgatcctgatggcgagccatagca ggcatcagcaaagctcctgcggcttgcccaagcgtcatcaatgccagtaaggaaccgctg tactgcgcgctggcaccaatctcaatatagaaagcgggtaaccaggcaatcaggctggcg taaccgccgttaatcagaccgaagtaaacacccagcgtccacgcgcggggagtgaatacc acgcgaaccggagtggttgttgtcttgtgggaagaggcgacctcgcgggcgctttgccac caccaggcaaagagcgcaacaacggcaggcagcgccaccaggcgagtgtttgataccagg tttcgctatgttgaactaaccagggcgttatggcggcaccaagcccaccgccgcccatca gagccgcggaccacagccccatcaccagtggcgtgcgctgctgaaaccgccgtttaatca ccgaagcatcaccgcctgaatgatgccgatccccaccccaccaagcagtgcgctgctaag cagcagcgcactttgcgggtaaagctcacgcatcaatgcaccgacggcaatcagcaacag actgatggcgacactgcgacgttcgctgacatgctgatgaagccagcttccggccagcgc cagcccgcccatggtaaccaccggcagagcggtcgac |
The output is a sequence file with 5 substitutions relative to the original sequence.
| Program name | Description |
|---|---|
| shuffleseq | Shuffles a set of sequences maintaining composition |