dan

 

Function

Calculates DNA RNA/DNA melting temperature

Description

Dan calculates the melting temperature (Tm) and the percent G+C of a nucleic acid sequence (optionally plotting them). For the Melting temperature profile, free energy values calculated from nearest neighbor thermodynamics are used (Breslauer et al. Proc. Natl. Acad. Sci. USA 83, 3746-3750 and Baldino et al. Methods in Enzymol. 168, 761-777).

Usage

Here is a sample session with dan

% dan 
Calculates DNA RNA/DNA melting temperature
Input sequence(s): tembl:paamir
Enter window size [20]: 
Enter Shift Increment [1]: 
Enter DNA concentration (nM) [50.]: 
Enter salt concentration (mM) [50.]: 
Output report [paamir.dan]: 

Go to the input files for this example
Go to the output files for this example

Example 2

An example of producing a plot of Tm:

% dan -plot -graph cps 
Calculates DNA RNA/DNA melting temperature
Input sequence(s): tembl:paamir
Enter window size [20]: 
Enter Shift Increment [1]: 
Enter DNA concentration (nM) [50.]: 
Enter salt concentration (mM) [50.]: 
Enter minimum temperature [55.]: 

Created dan.ps

Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers (* if not always prompted):
  [-sequence]          seqall     Sequence database USA
   -windowsize         integer    The values of melting point and other
                                  thermodynamic properties of the sequence are
                                  determined by taking a short length of
                                  sequence known as a window and determining
                                  the properties of the sequence in that
                                  window. The window is incrementally moved
                                  along the sequence with the properties being
                                  calculated at each new position.
   -shiftincrement     integer    This is the amount by which the window is
                                  moved at each increment in order to find the
                                  melting point and other properties along
                                  the sequence.
   -dnaconc            float      Enter DNA concentration (nM)
   -saltconc           float      Enter salt concentration (mM)
*  -mintemp            float      Enter a minimum value for the temperature
                                  scale (y-axis) of the plot.
*  -graph              xygraph    Graph type
*  -outfile            report     If a plot is not being produced then data on
                                  the melting point etc. in each window along
                                  the sequence is output to the file.

   Additional (Optional) qualifiers (* if not always prompted):
   -product            toggle     This prompts for percent formamide, percent
                                  of mismatches allowed and product length.
*  -formamide          float      This specifies the percent formamide to be
                                  used in calculations (it is ignored unless
                                  -product is used).
*  -mismatch           float      This specifies the percent mismatch to be
                                  used in calculations (it is ignored unless
                                  -product is used).
*  -prodlen            integer    This specifies the product length to be used
                                  in calculations (it is ignored unless
                                  -product is used).
   -thermo             toggle     Output the DeltaG, DeltaH and DeltaS values
                                  of the sequence windows to the output data
                                  file.
*  -temperature        float      If -thermo has been specified then this
                                  specifies the temperature at which to
                                  calculate the DeltaG, DeltaH and DeltaS
                                  values.

   Advanced (Unprompted) qualifiers:
   -rna                boolean    This specifies that the sequence is an RNA
                                  sequence and not a DNA sequence.
   -plot               toggle     If this is not specified then the file of
                                  output data is produced, else a plot of the
                                  melting point along the sequence is
                                  produced.

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1             integer    Start of each sequence to be used
   -send1               integer    End of each sequence to be used
   -sreverse1           boolean    Reverse (if DNA)
   -sask1               boolean    Ask for begin/end/reverse
   -snucleotide1        boolean    Sequence is nucleotide
   -sprotein1           boolean    Sequence is protein
   -slower1             boolean    Make lower case
   -supper1             boolean    Make upper case
   -sformat1            string     Input sequence format
   -sdbname1            string     Database name
   -sid1                string     Entryname
   -ufo1                string     UFO features
   -fformat1            string     Features format
   -fopenfile1          string     Features file name

   "-graph" associated qualifiers
   -gprompt             boolean    Graph prompting
   -gtitle              string     Graph title
   -gsubtitle           string     Graph subtitle
   -gxtitle             string     Graph x axis title
   -gytitle             string     Graph y axis title
   -goutfile            string     Output file for non interactive displays
   -gdirectory          string     Output directory

   "-outfile" associated qualifiers
   -rformat             string     Report format
   -rname               string     Base file name
   -rextension          string     File name extension
   -rdirectory          string     Output directory
   -raccshow            boolean    Show accession number in the report
   -rdesshow            boolean    Show description in the report
   -rscoreshow          boolean    Show the score in the report
   -rusashow            boolean    Show the full USA in the report

   General qualifiers:
   -auto                boolean    Turn off prompts
   -stdout              boolean    Write standard output
   -filter              boolean    Read standard input, write standard output
   -options             boolean    Prompt for standard and additional values
   -debug               boolean    Write debug output to program.dbg
   -verbose             boolean    Report some/full command line options
   -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning             boolean    Report warnings
   -error               boolean    Report errors
   -fatal               boolean    Report fatal errors
   -die                 boolean    Report deaths


Standard (Mandatory) qualifiers Allowed values Default
[-sequence]
(Parameter 1)
Sequence database USA Readable sequence(s) Required
-windowsize The values of melting point and other thermodynamic properties of the sequence are determined by taking a short length of sequence known as a window and determining the properties of the sequence in that window. The window is incrementally moved along the sequence with the properties being calculated at each new position. Integer from 1 to 100 20
-shiftincrement This is the amount by which the window is moved at each increment in order to find the melting point and other properties along the sequence. Integer 1 or more 1
-dnaconc Enter DNA concentration (nM) Number from 1.000 to 100000.000 50.
-saltconc Enter salt concentration (mM) Number from 1.000 to 1000.000 50.
-mintemp Enter a minimum value for the temperature scale (y-axis) of the plot. Number from 0.000 to 150.000 55.
-graph Graph type EMBOSS has a list of known devices, including postscript, ps, hpgl, hp7470, hp7580, meta, colourps, cps, xwindows, x11, tektronics, tekt, tek4107t, tek, none, null, text, data, xterm, png, xml EMBOSS_GRAPHICS value, or x11
-outfile If a plot is not being produced then data on the melting point etc. in each window along the sequence is output to the file. Report output file  
Additional (Optional) qualifiers Allowed values Default
-product This prompts for percent formamide, percent of mismatches allowed and product length. Toggle value Yes/No No
-formamide This specifies the percent formamide to be used in calculations (it is ignored unless -product is used). Number from 0.000 to 100.000 0.
-mismatch This specifies the percent mismatch to be used in calculations (it is ignored unless -product is used). Number from 0.000 to 100.000 0.
-prodlen This specifies the product length to be used in calculations (it is ignored unless -product is used). Any integer value Window size (20)
-thermo Output the DeltaG, DeltaH and DeltaS values of the sequence windows to the output data file. Toggle value Yes/No No
-temperature If -thermo has been specified then this specifies the temperature at which to calculate the DeltaG, DeltaH and DeltaS values. Number from 0.000 to 100.000 25.
Advanced (Unprompted) qualifiers Allowed values Default
-rna This specifies that the sequence is an RNA sequence and not a DNA sequence. Boolean value Yes/No No
-plot If this is not specified then the file of output data is produced, else a plot of the melting point along the sequence is produced. Toggle value Yes/No No

Input file format

Any DNA or RNA sequence USA.

Input files for usage example

'tembl:paamir' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:paamir

ID   PAAMIR     standard; DNA; PRO; 2167 BP.
XX
AC   X13776; M43175;
XX
SV   X13776.1
XX
DT   19-APR-1989 (Rel. 19, Created)
DT   17-FEB-1997 (Rel. 50, Last updated, Version 22)
XX
DE   Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW   aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS   Pseudomonas aeruginosa
OC   Bacteria; Proteobacteria; gamma subdivision; Pseudomonadaceae; Pseudomonas.
XX
RN   [1]
RP   1167-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
RN   [2]
RP   1167-2167
RX   MEDLINE; 89211409.
RA   Lowe N., Rice P.M., Drew R.E.;
RT   "Nucleotide sequence of the aliphatic amidase regulator gene of Pseudomonas
RT   aeruginosa";
RL   FEBS Lett. 246:39-43(1989).
XX
RN   [3]
RP   1-1292
RX   MEDLINE; 91317707.
RA   Wilson S., Drew R.;
RT   "Cloning and DNA seqence of amiC, a new gene regulating expression of the
RT   Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT   product.";
RL   J. Bacteriol. 173:4914-4921(1991).
XX
RN   [4]
RP   1-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
DR   SWISS-PROT; P10932; AMIR_PSEAE.
DR   SWISS-PROT; P27017; AMIC_PSEAE.
DR   SWISS-PROT; Q51417; AMIS_PSEAE.


  [Part of this file has been deleted for brevity]

FT                   phenotype"
FT                   /replace=""
FT                   /gene="amiC"
FT   misc_feature    1
FT                   /note="last base of an XhoI site"
FT   misc_feature    648..653
FT                   /note="end of 658bp XhoI fragment, deletion in  pSW3 causes
FT                   constitutive expression of amiE"
FT   conflict        1281
FT                   /replace="g"
FT                   /citation=[3]
XX
SQ   Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
     ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat        60
     ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac       120
     aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg       180
     aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg       240
     agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc       300
     ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg       360
     tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg       420
     agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga       480
     acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga       540
     ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa       600
     gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct       660
     acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg       720
     cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg       780
     ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg       840
     aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt       900
     acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct       960
     tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc      1020
     tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt      1080
     acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca      1140
     gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc      1200
     agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt      1260
     ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg      1320
     cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca      1380
     gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt      1440
     gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc      1500
     gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc      1560
     cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga      1620
     tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa      1680
     gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca      1740
     ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct      1800
     gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg      1860
     aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt      1920
     catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg      1980
     gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct      2040
     gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa      2100
     ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt      2160
     cctcgag                                                                2167
//

Output file format

If a plot is not being produced, dan reports the sequence of each oligomer window, its melting temperature under the specified conditions and its GC content.

The output is a standard EMBOSS report file.

The results can be output in one of several styles by using the command-line qualifier -rformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, trace, listfile, dbmotif, diffseq, excel, feattable, motif, regions, seqtable, simple, srs, table, tagseq

See: http://emboss.sf.net/docs/themes/ReportFormats.html for further information on report formats.

By default dan writes a 'seqtable' report file.

Output files for usage example

File: paamir.dan

########################################
# Program: dan
# Rundate: Fri Jul 15 2005 12:00:00
# Report_format: seqtable
# Report_file: paamir.dan
########################################

#=======================================
#
# Sequence: PAAMIR     from: 1   to: 2167
# HitCount: 2148
#=======================================

  Start     End     Tm     GC DeltaG DeltaH DeltaS TmProd Sequence
      1      20   64.9   70.0      .      .      .      . ggtaccgctggccgagcatc
      2      21   63.7   65.0      .      .      .      . gtaccgctggccgagcatct
      3      22   63.7   65.0      .      .      .      . taccgctggccgagcatctg
      4      23   66.9   70.0      .      .      .      . accgctggccgagcatctgc
      5      24   66.7   70.0      .      .      .      . ccgctggccgagcatctgct
      6      25   65.5   70.0      .      .      .      . cgctggccgagcatctgctc
      7      26   65.5   70.0      .      .      .      . gctggccgagcatctgctcg
      8      27   63.7   65.0      .      .      .      . ctggccgagcatctgctcga
      9      28   62.9   60.0      .      .      .      . tggccgagcatctgctcgat
     10      29   62.6   65.0      .      .      .      . ggccgagcatctgctcgatc
     11      30   61.7   60.0      .      .      .      . gccgagcatctgctcgatca
     12      31   60.2   60.0      .      .      .      . ccgagcatctgctcgatcac
     13      32   60.2   60.0      .      .      .      . cgagcatctgctcgatcacc
     14      33   59.0   55.0      .      .      .      . gagcatctgctcgatcacca
     15      34   59.2   55.0      .      .      .      . agcatctgctcgatcaccac
     16      35   60.4   60.0      .      .      .      . gcatctgctcgatcaccacc
     17      36   58.9   55.0      .      .      .      . catctgctcgatcaccacca
     18      37   58.6   55.0      .      .      .      . atctgctcgatcaccaccag
     19      38   61.3   60.0      .      .      .      . tctgctcgatcaccaccagc
     20      39   62.4   65.0      .      .      .      . ctgctcgatcaccaccagcc
     21      40   63.9   65.0      .      .      .      . tgctcgatcaccaccagccg
     22      41   64.9   70.0      .      .      .      . gctcgatcaccaccagccgg
     23      42   64.3   70.0      .      .      .      . ctcgatcaccaccagccggg
     24      43   66.1   70.0      .      .      .      . tcgatcaccaccagccgggc
     25      44   67.5   75.0      .      .      .      . cgatcaccaccagccgggcg
     26      45   66.1   70.0      .      .      .      . gatcaccaccagccgggcga
     27      46   66.3   70.0      .      .      .      . atcaccaccagccgggcgac
     28      47   68.6   75.0      .      .      .      . tcaccaccagccgggcgacg
     29      48   69.8   80.0      .      .      .      . caccaccagccgggcgacgg
     30      49   70.7   80.0      .      .      .      . accaccagccgggcgacggg
     31      50   70.5   80.0      .      .      .      . ccaccagccgggcgacggga
     32      51   68.6   75.0      .      .      .      . caccagccgggcgacgggaa
     33      52   68.6   75.0      .      .      .      . accagccgggcgacgggaac
     34      53   68.4   75.0      .      .      .      . ccagccgggcgacgggaact
     35      54   67.4   75.0      .      .      .      . cagccgggcgacgggaactg
     36      55   68.9   75.0      .      .      .      . agccgggcgacgggaactgc


  [Part of this file has been deleted for brevity]

   2101    2120   69.9   80.0      .      .      .      . ggccggagcgctgaccctgc
   2102    2121   68.7   75.0      .      .      .      . gccggagcgctgaccctgct
   2103    2122   65.5   70.0      .      .      .      . ccggagcgctgaccctgcta
   2104    2123   63.5   65.0      .      .      .      . cggagcgctgaccctgctat
   2105    2124   61.3   60.0      .      .      .      . ggagcgctgaccctgctatt
   2106    2125   60.1   60.0      .      .      .      . gagcgctgaccctgctattc
   2107    2126   61.7   60.0      .      .      .      . agcgctgaccctgctattcg
   2108    2127   63.4   65.0      .      .      .      . gcgctgaccctgctattcgc
   2109    2128   61.7   60.0      .      .      .      . cgctgaccctgctattcgct
   2110    2129   59.5   55.0      .      .      .      . gctgaccctgctattcgctt
   2111    2130   57.1   50.0      .      .      .      . ctgaccctgctattcgcttt
   2112    2131   56.4   45.0      .      .      .      . tgaccctgctattcgctttt
   2113    2132   54.7   45.0      .      .      .      . gaccctgctattcgctttta
   2114    2133   55.0   45.0      .      .      .      . accctgctattcgcttttac
   2115    2134   55.9   50.0      .      .      .      . ccctgctattcgcttttacc
   2116    2135   54.7   45.0      .      .      .      . cctgctattcgcttttacct
   2117    2136   52.0   40.0      .      .      .      . ctgctattcgcttttaccta
   2118    2137   51.2   35.0      .      .      .      . tgctattcgcttttacctat
   2119    2138   50.9   40.0      .      .      .      . gctattcgcttttacctatc
   2120    2139   49.0   35.0      .      .      .      . ctattcgcttttacctatct
   2121    2140   49.3   35.0      .      .      .      . tattcgcttttacctatctg
   2122    2141   51.1   35.0      .      .      .      . attcgcttttacctatctgt
   2123    2142   52.2   40.0      .      .      .      . ttcgcttttacctatctgtg
   2124    2143   54.0   45.0      .      .      .      . tcgcttttacctatctgtgg
   2125    2144   55.2   50.0      .      .      .      . cgcttttacctatctgtggg
   2126    2145   53.9   45.0      .      .      .      . gcttttacctatctgtgggt
   2127    2146   52.3   45.0      .      .      .      . cttttacctatctgtgggtg
   2128    2147   53.5   45.0      .      .      .      . ttttacctatctgtgggtgg
   2129    2148   56.0   50.0      .      .      .      . tttacctatctgtgggtggc
   2130    2149   57.8   55.0      .      .      .      . ttacctatctgtgggtggcc
   2131    2150   60.1   60.0      .      .      .      . tacctatctgtgggtggccg
   2132    2151   63.4   65.0      .      .      .      . acctatctgtgggtggccgc
   2133    2152   64.3   70.0      .      .      .      . cctatctgtgggtggccgcc
   2134    2153   63.4   65.0      .      .      .      . ctatctgtgggtggccgcca
   2135    2154   62.7   60.0      .      .      .      . tatctgtgggtggccgccaa
   2136    2155   64.5   65.0      .      .      .      . atctgtgggtggccgccaac
   2137    2156   66.5   70.0      .      .      .      . tctgtgggtggccgccaacc
   2138    2157   66.8   70.0      .      .      .      . ctgtgggtggccgccaacca
   2139    2158   66.8   70.0      .      .      .      . tgtgggtggccgccaaccag
   2140    2159   66.8   70.0      .      .      .      . gtgggtggccgccaaccagt
   2141    2160   65.9   65.0      .      .      .      . tgggtggccgccaaccagtt
   2142    2161   65.6   70.0      .      .      .      . gggtggccgccaaccagttc
   2143    2162   65.6   70.0      .      .      .      . ggtggccgccaaccagttcc
   2144    2163   64.4   65.0      .      .      .      . gtggccgccaaccagttcct
   2145    2164   64.1   65.0      .      .      .      . tggccgccaaccagttcctc
   2146    2165   65.4   70.0      .      .      .      . ggccgccaaccagttcctcg
   2147    2166   64.2   65.0      .      .      .      . gccgccaaccagttcctcga
   2148    2167   62.4   65.0      .      .      .      . ccgccaaccagttcctcgag

#---------------------------------------
#---------------------------------------

Output files for usage example 2

Graphics File: dan.ps

[dan results]

File: paamir.dan


The header information contains details of the program, date and sequence

Subsequent lines contain columns of data for each window into the sequence as it is moved along, giving:

If the qualifier '-product' is used to make the program prompt for percent formamide percent of mismatches allowed and product length, then the output includes the melting temperature of the specified product.

If the qualifier '-thermo' is gived then the DeltaG, DeltaH and DeltaS of the sequence in the window is also output.

Data files

The EMBOSS data files "Edna.melt" and "Erna.melt" are used to read in the entropy/enthalpy/energy data for DNA and RNA respectively.

EMBOSS data files are distributed with the application and stored in the standard EMBOSS data directory, which is defined by the EMBOSS environment variable EMBOSS_DATA.

To see the available EMBOSS data files, run:

% embossdata -showall

To fetch one of the data files (for example 'Exxx.dat') into your current directory for you to inspect or modify, run:

% embossdata -fetch -file Exxx.dat

Users can provide their own data files in their own directories. Project specific files can be put in the current directory, or for tidier directory listings in a subdirectory called ".embossdata". Files for all EMBOSS runs can be put in the user's home directory, or again in a subdirectory called ".embossdata".

The directories are searched in the following order:

Notes

None.

References

  1. Breslauer, K.J., Frank, R., Blocker, H., and Marky, L.A. (1986). "Predicting DNA Duplex Stability from the Base Sequence." Proceedings of the National Academy of Sciences USA 83, 3746-3750.
  2. Baldino, M., Jr. (1989). "High Resolution In Situ Hybridization Histochemistry." In Methods in Enzymology, (P.M. Conn, ed.), 168, 761-777, Academic Press, San Diego, California, USA.

Warnings

RNA sequences must be submited to this application with the '-rna' qualifier on the command line, otherwise the sequence will be assumed to be DNA.

Diagnostic Error Messages

None.

Exit status

0 if successful.

Known bugs

None.

See also

Program nameDescription
bananaBending and curvature plot in B-DNA
btwistedCalculates the twisting in a B-DNA sequence
chaosCreate a chaos game representation plot for a sequence
compseqCount composition of dimer/trimer/etc words in a sequence
freakResidue/base frequency table or plot
isochorePlots isochores in large DNA sequences
sirnaFinds siRNA duplexes in mRNA
wordcountCounts words of a specified size in a DNA sequence

Author(s)

This program was originally included in EGCG under the names "MELT" and "MELTPLOT", written by Rodrigo Lopez (rls © ebi.ac.uk)
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

This application was written by Alan Bleasby (ajb © ebi.ac.uk)
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

History

Written (1999) - Alan Bleasby

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None