abiview

 

Function

Reads ABI file and display the trace

Description

abiview reads in an ABI sequence trace file and graphically displays the results.

The data for each nucleotide is plotted and the assigned nucleotide (G, A, T, C or N) in the ABI file is overlayed on the graphs.

It also writes out the sequence to an output sequence file.

Usage

Here is a sample session with abiview 


% abiview -graph cps 
Reads ABI file and display the trace
ABI trace file: abiview.abi
Output sequence [abiview.fasta]: 

Created abiview.ps

Go to the input files for this example
Go to the output files for this example

Command line arguments 

   Standard (Mandatory) qualifiers:
  [-infile]            infile     ABI trace file
  [-outseq]            seqout     Output sequence USA
   -graph              xygraph    Graph type

   Additional (Optional) qualifiers:
   -startbase          integer    First base to report or display
   -endbase            integer    Last sequence base to report or display. If
                                  the default is set to zero then the value of
                                  this is taken as the maximum number of
                                  bases.
   -yticks             boolean    Display y-axis ticks
   -[no]sequence       boolean    Display the sequence on the graph
   -window             integer    Sequence display window size
   -bases              string     Base graphs to be displayed

   Advanced (Unprompted) qualifiers:
   -separate           boolean    Separate the trace graphs for the 4 bases

   Associated qualifiers:

   "-outseq" associated qualifiers
   -osformat2           string     Output seq format
   -osextension2        string     File name extension
   -osname2             string     Base file name
   -osdirectory2        string     Output directory
   -osdbname2           string     Database name to add
   -ossingle2           boolean    Separate file for each entry
   -oufo2               string     UFO features
   -offormat2           string     Features format
   -ofname2             string     Features file name
   -ofdirectory2        string     Output directory

   "-graph" associated qualifiers
   -gprompt             boolean    Graph prompting
   -gtitle              string     Graph title
   -gsubtitle           string     Graph subtitle
   -gxtitle             string     Graph x axis title
   -gytitle             string     Graph y axis title
   -goutfile            string     Output file for non interactive displays
   -gdirectory          string     Output directory

   General qualifiers:
   -auto                boolean    Turn off prompts
   -stdout              boolean    Write standard output
   -filter              boolean    Read standard input, write standard output
   -options             boolean    Prompt for standard and additional values
   -debug               boolean    Write debug output to program.dbg
   -verbose             boolean    Report some/full command line options
   -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning             boolean    Report warnings
   -error               boolean    Report errors
   -fatal               boolean    Report fatal errors
   -die                 boolean    Report deaths

Standard (Mandatory) qualifiers Allowed values Default
[-infile]
(Parameter 1)		 ABI trace file Input file Required
[-outseq]
(Parameter 2)		 Output sequence USA Writeable sequence <sequence>.format
-graph Graph type EMBOSS has a list of known devices, including postscript, ps, hpgl, hp7470, hp7580, meta, colourps, cps, xwindows, x11, tektronics, tekt, tek4107t, tek, none, null, text, data, xterm, png, xml EMBOSS_GRAPHICS value, or x11
Additional (Optional) qualifiers Allowed values Default
-startbase First base to report or display Integer 0 or more 0
-endbase Last sequence base to report or display. If the default is set to zero then the value of this is taken as the maximum number of bases. Any integer value 0
-yticks Display y-axis ticks Boolean value Yes/No No
-[no]sequence Display the sequence on the graph Boolean value Yes/No Yes
-window Sequence display window size Any integer value 40
-bases Base graphs to be displayed Any string is accepted, matching regular expression /[GATC]+/ GATC
Advanced (Unprompted) qualifiers Allowed values Default
-separate Separate the trace graphs for the 4 bases Boolean value Yes/No No

Input file format

This reads in a standard ABI trace file.

Input files for usage example

File: abiview.abi

This file contains non-printing characters and so cannot be displayed here.

File: abiview.abi

This file contains non-printing characters and so cannot be displayed here.

Output file format

It outputs a file holding a normal nucleotide sequence.

Output files for usage example

File: abiview.fasta

>../../data/abiview.abi
GNNNNNNNNNGNGNNGGGGTTTNANNNTNNNAGAACCCCCCTTNGAAAANNNCCACCCCA
NNATAGTNGTANGAATAGTNCCCAGGCCANGCCTATCTGTGATGATTACATAGGCTAACA
CATGACAAACATTTAAAAACACTAAACAATTGTTATTTATTCTTTGTTCCTATAAACCAC
ACCCATTAAGCCCTTACTATATATAAGAGTTTTCAAGCCAAGAACCTGCTGCTTGGGAGG
CTGATGCAGGAGAATTGCCAAGTACAAACCCTGCCTGGACTGTAAAGTGAAACCAAGGCT
AGTTGTCTCACAATAAAAGATGAAGGGCAAGTGGGATCAATGCATAAAGGAGCTTGTGCC
CAAGCCTGTTAGCCTTAGTTCAATTCCTGAGTACCATGAAAAGGTAGAAGGAGAGAAATG
ATTTGGTACAATTTTTCTCTGTGCTGTGACACAGTACCACCCTCCTACTAATAACAAATA
AAATAATGTTTAAAACAAAATAAAATAAAAATGGACTGGGATGTAGCACAATGGTAGGGT
ACTTGCATAGCATGTACAAGGACCTGATTTCAATCCCCTGTGATAAAAGAAAATAAGGAA
GGGAGGAAGCGTTAGGAGGAAAAATGGAATACAGAAGACACAGTGCATGGGAAGGATATG
TATGTTATGAACACCAGAAATTCACTTGAAAATGAGTAAAATTTTTTTATTATTATATCA
TTATTATTGGGGGGGATGTGGGCGGGGCTTGCAGAGGTATCTTTTAGAGGANGATCATTT
TCCGGTTGTTGAGCAGGGCTCTGTTATGTAGGATATCTCAGANTAACAGACCCCAGGT

Graphics File: abiview.ps

[abiview results]

The horizontal scale of the output image labelled 'Residue Position' is only a very approximate indication of the spacing of residues in the image. The real residue spacing is variable, as it relies on the speed with which the oligo-nucleotides are eluted in the ABI sequencer. Do not be surprised to see the nucleotide signals spaced at a much greater distance than the horizontal scale might suggest.

Data files

None.

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program nameDescription
cirdnaDraws circular maps of DNA constructs
lindnaDraws linear maps of DNA constructs
pepnetDisplays proteins as a helical net
pepwheelShows protein sequences as helices
prettyplotDisplays aligned sequences, with colouring and boxing
prettyseqOutput sequence with translated ranges
remapDisplay sequence with restriction sites, translation etc
seealsoFinds programs sharing group names
showalignDisplays a multiple sequence alignment
showdbDisplays information on the currently available databases
showfeatShow features of a sequence
showseqDisplay a sequence with features, translation etc
sixpackDisplay a DNA sequence with 6-frame translation and ORFs
textsearchSearch sequence documentation. Slow, use SRS and Entrez!

Author(s)

Tim Carver (tcarver © rfcgr.mrc.ac.uk)
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

History

Written (January 2001) - Tim Carver

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None